Related Searches
Recent Searches
Popular Searches
- billboard advertising
- billboard advertising system
- mobile billboard advertising system
- bombardier rotax gmbh
- mobile billboard system
- billboard system
- mobile multi message billboard advertising
- linux
- multi message billboard advertising system
- using domain
- multimedia advertising billboard
- brown midrib
- advertising billboard
- g fl peg
- mobile billboard advertising
33 human secreted proteins
Filed: October 3rd, 2005 [Pending]
Assignee: Human Genome Sciences Inc
Patent Application Number: 11240769
Anti-ICAM-l-Biotin, Anti-VCAM-l-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 fig/ml (1:10 dilution of 0.1 mg/ml stock antibody).
Mature type-1 polarized dendritic cells with enhanced IL-12 production and ...
Filed: June 12th, 2008 [Granted]
Patent Number: 7972847
1._..,.__,_ >~\“ ' l I 0 I '-\= I 33..1 11..1 4..1 33". ... _...1. 80% - T --A 70% - - -60% — 50% — 40% — 30% ~ 20% - 1 10% —— O0/0 -1 1 1 ' '_ " 1 1 1 ...
Electrical connector with filter
Filed: January 17th, 1997 [Granted]
Assignee: Nippon Carbide Kogyo Kabushiki Kaisha
Patent Number: 5704810
3 4 elements 33 can be inserted therein respectively. ... function 10 is not necessary to stance comP"ses * £*,onc ~^"n ^ 1°^^ be formed on the periphery of ...
Crystal structures of streptococcus undecaprenyl pyrophosphate synthase and ...
Filed: March 31st, 2004 [Pending]
Assignee: Pfizer Inc
Patent Application Number: 10815402
51 C ATOM 1923 C THR B 54 10 . .295 32 , .298 33 , . 033 1. . 00 42 . ... 99 O ATOM 1925 N VAL B 55 10 , . 118 33 . .603 33 , . 099 1. . 00 41 .
Overhead scanning profiler
Filed: March 23rd, 1998 [Granted]
Assignee: Sloan Technologies Incorporated
Patent Number: 6161294
... G01B 1/00 [52] US CI 33/1 M; 33/503; 33/533; 33/549; 73/104; ... 250/572 4755746 7/1988 Mallory et al 324/158 F 4778313 10/1988 Lekmkuhl 33/561 4945501 ...
Process for producing toner particles, and toner
Filed: July 13th, 2004 [Pending]
Assignee: CANON KABUSHIKI KAISHA
Patent Application Number: 10889073
... TABLE 1 [0245] TABLE 2 Example: Weight = average particle diameter (jim) ... 0.60 9 205 120 AB 500 0.60 10 205 120 AB 500 0.55 11 205 120 AB 500 0.65 12 ...
Benzoxazole compound, process for producing the same, and herbicide
Filed: January 6th, 2003 [Pending]
Patent Application Number: 10332359
... „15 Physical Y' properties W-15-1 HF OCH3 HHH OCH3 O W-15-2 HF CH3 HH CF3 CI O [0355] TABLE 16 (W-17) [0358] TABLE 19 (W-33) Compound R1 R2 R3 R4 R8 R14 ...
Modulation of estrogen-responsive finger protein expression
Filed: December 10th, 2002 [Pending]
Assignee: Isis Pharmaceuticals Inc
Patent Application Number: 10317277
20 TABLE 1-continued Inhibition of human estrogen-responsive finger protein ... 66 32 1 285782 exon 4 807 gcacaccaagcacgtcttca 69 33 1 285783 exon 4 824 ...
