Containing epitopes patents

Cancer vaccines containing epitopes of oncofetal antigen

Filed: August 5th, 2009 [Pending]

Assignee: South Alabama Medical Science Foundation

Patent Application Number: 12462514

22, 2010 (54) CANCER VACCINES CONTAINING Related US Application Data EPITOPES OF ONCOFETAL ANTIGEN (63) Continuation of application No.

Cancer vaccines containing epitopes of oncofetal antigen

Filed: August 4th, 2003 [Pending]

Assignee: SOUTH Alabama Medical Sciences Foundation

Patent Application Number: 10523277

6 -continued OFA AACCTGCCCACCATTGCTCTGTGTAACACAGATTCTCCCCTGCGCTATGTGGACATTGCC llllllllllllllllllllllllllllllllllllllllll lllllllllllllll iLRP ...

Compositions and methods for treating viral infections

Filed: November 5th, 2001 [Granted]

Assignee: Virionyx Corporation

Patent Number: 6670181

The solution containing the epitopes then is contacted with the immobilized ... Similarly, proteins or peptides containing epitopes of HIV or mimicking ...

Compositions and method for treating viral infections

Filed: November 28th, 2006 [Pending]

Patent Application Number: 11605017

The solution containing the epitopes then is contacted with the ... [0121] Similarly, proteins or peptides containing epitopes of HIV or mimicking epitopes ...

Epitope sequences

Filed: September 5th, 2003 [Pending]

Patent Application Number: 10657022

603-610 can be useful as sequences containing epitopes or epitope clusters, as described in various embodiments of the invention.

Immuno-reactive peptide CTL epitopes of human cytomegalovirus

Filed: October 20th, 2000 [Granted]

Assignee: City of Hope

Patent Number: 6562345

This experiment was repeated with at least three independent cell lines containing the restricting allele. Table 6 shows the pp65 epitopes, ...

ANTIBODIES RECOGNIZING A CARBOHYDRATE CONTAINING EPITOPE ON CD-43 AND CEA ...

Filed: December 18th, 2008 [Pending]

Patent Application Number: 12338934

Cancer cells or extracellular domain (including fragments thereof) containing the epitope may be used for testing. [0095] Jurkat cell line is a ...

Antibodies for ubiquitinated proteins

Filed: June 2nd, 2009 [Pending]

Assignee: Cornell Research Foundation Inc

Patent Application Number: 12455496

[0055] The diglycine-lysine containing epitope(s) can be placed on one or more lysine residues in a selected protein. Such a protein can be carrier that ...